KudoZ home » English to German » Genetics

abundance

German translation: Häufigkeit; Abundanz

Advertisement

Login or register (free and only takes a few minutes) to participate in this question.

You will also have access to many other tools and opportunities designed for those who have language-related jobs
(or are passionate about them). Participation is free and the site has a strict confidentiality policy.
15:55 Sep 23, 2007
English to German translations [PRO]
Science - Genetics
English term or phrase: abundance
To assess the tissue distribution of AB014553 cDNA and AB014553 RACE clones, RT-PCR/southern blot analyses were performed under similar conditions as for the GL50 sequences described above.Using oligonucleotides primers specific for the amplification of published AB014553 cDNA (VL142 (ACAACAGCCTGCTGGACCAGGC; SEQ ID NO:10) and VL163B (GGGCCCCCCAGAACCTGCTGCTTCC; SEQ ID NO:17)), PCR resulted in the complete absence of any detectable AB014553 cDNA signal for all samples tested (Figure 10).Possible explanations for the lack of RT-PCR products representing published AB014553 cDNA sequences may be the use of non-optimized oligonucleotides, extremely low ***abundance*** of the target transcript, or actual absence of this form of the product.
Evelyn Cölln
Local time: 03:51
German translation:Häufigkeit; Abundanz
Explanation:
Beispiel

DNA – die Gene kommen in gleicher. Kopienzahl im Genom vor. Ausnahmen sind. amplifizierte Gene. RNA – die Abundanz der mRNA kann über ...
www.dkfz.de/mga/home/wiemann/Seminare HP-E1 Nukleinsaeuren ...
Selected response from:

sci-trans
Local time: 03:51
Grading comment
Vielen Dank, sci-trans! Ich habe mich für Häufigkeit etschieden!
4 KudoZ points were awarded for this answer

Advertisement


Summary of answers provided
4 +5Häufigkeit; Abundanzsci-trans
3extrem geringCarmen Archouniani


  

Answers


9 mins   confidence: Answerer confidence 4/5Answerer confidence 4/5 peer agreement (net): +5
Häufigkeit; Abundanz


Explanation:
Beispiel

DNA – die Gene kommen in gleicher. Kopienzahl im Genom vor. Ausnahmen sind. amplifizierte Gene. RNA – die Abundanz der mRNA kann über ...
www.dkfz.de/mga/home/wiemann/Seminare HP-E1 Nukleinsaeuren ...

sci-trans
Local time: 03:51
Native speaker of: German
PRO pts in category: 16
Grading comment
Vielen Dank, sci-trans! Ich habe mich für Häufigkeit etschieden!

Peer comments on this answer (and responses from the answerer)
agree  xxxDr.G.MD
3 hrs

agree  Dr. Matthias Schauen
3 hrs

agree  Serena Rohrbeck
4 hrs

agree  KARIN ISBELL
4 hrs

agree  s4saveen
5 hrs
Login to enter a peer comment (or grade)

2 hrs   confidence: Answerer confidence 3/5Answerer confidence 3/5
extrem gering


Explanation:
use it as an adjective

--------------------------------------------------
Note added at 8 hrs (2007-09-24 00:50:46 GMT)
--------------------------------------------------

extrem geringe Ziel...(whatever word you have, haven't done research for that) oder gar keine Form dieses Produktes.

Carmen Archouniani
Native speaker of: Native in ArmenianArmenian
Notes to answerer
Asker: "extrem geringe" - and what?

Login to enter a peer comment (or grade)




Return to KudoZ list


Changes made by editors
Sep 24, 2007 - Changes made by Steffen Walter:
Field (specific)Medical (general) » Genetics
Field (write-in)Genetik » (none)


KudoZ™ translation help
The KudoZ network provides a framework for translators and others to assist each other with translations or explanations of terms and short phrases.



See also:



Term search
  • All of ProZ.com
  • Term search
  • Jobs
  • Forums
  • Multiple search