The alpha chain variable region sequence specific oligonucleotide A1

Russian translation: специфический олигонуклеотид А1 вариабельной области альфа-цепи

08:50 Jun 3, 2018
English to Russian translations [PRO]
Science - Biology (-tech,-chem,micro-)
English term or phrase: The alpha chain variable region sequence specific oligonucleotide A1
The alpha chain variable region sequence specific oligonucleotide A1 which encodes the restriction site...
Local time: 06:52
Russian translation:специфический олигонуклеотид А1 вариабельной области альфа-цепи
специфический олигонуклеотид А1 вариабельной области альфа-цепи, кодирующий... и тд
Selected response from:

Local time: 05:52
Grading comment
Selected automatically based on peer agreement.
4 KudoZ points were awarded for this answer

Summary of answers provided
4 +3специфический олигонуклеотид А1 вариабельной области альфа-цепи
Igor Andreev



13 mins   confidence: Answerer confidence 4/5Answerer confidence 4/5 peer agreement (net): +3
the alpha chain variable region sequence specific oligonucleotide a1
специфический олигонуклеотид А1 вариабельной области альфа-цепи

специфический олигонуклеотид А1 вариабельной области альфа-цепи, кодирующий... и тд

Local time: 05:52
Specializes in field
Native speaker of: Native in RussianRussian
PRO pts in category: 4013
Grading comment
Selected automatically based on peer agreement.
Notes to answerer
Asker: Спасибо!

Peer comments on this answer (and responses from the answerer)
agree  Marlin31
1 hr
  -> Спасибо!

agree  Igor Andreev
3 hrs
  -> Спасибо!

agree  Vest: Только «последовательность» я бы не опускала.
1 day 3 hrs
  -> Можно и не опускать, тогда получится "последовательность специфического олигонуклеотида", что несколько избыточно. Спасибо!
Login to enter a peer comment (or grade)

5 hrs   confidence: Answerer confidence 4/5Answerer confidence 4/5
the alpha chain variable region sequence specific oligonucleotide a1

полез в патент в итоге )
в контексте это скорее
олигонуклеотид А1, специфичный/ гомологичный к последовательности вариабельного участка альфа цепи,
который использовали в качестве праймера для ПЦР

The reference gp100 TCR variable alpha and TCR variable beta domains were PCR amplified from total cDNA isolated from a gp100 T cell clone. In the case of the alpha chain, an alpha chain variable region sequence specific oligonucleotide A1 (ggaattccatatgagtcaacaaggagaagaagatcc SEQ ID No:39) which encodes the restriction site Ndel....

The reference MAGE-A3 TCR variable alpha and TCR variable beta domains were PCR amplified from total cDNA isolated from a MAGE-3 T cell clone (Clone EB81- 103 from Pierre Coulie University of Louvain, Belgium). In the case of the alpha chain, an alpha chain variable region sequence specific oligonucleotide A1
(ggaattccatatgaaacaagaagttactcaaattcc SEQ ID No: 14) which encodes the restriction site Ndel ...

Note added at 5 hrs (2018-06-03 14:44:43 GMT)

а вот собственно и оригинал
The alpha chain variable region sequence specific oligonucleotide A1 which encodes the restriction site NdeI, an introduced methionine for efficient initiation of expression in bacteria, and an alpha chain constant region sequence specific oligonucleotide A2 which encodes the restriction site SalI are used to amplify the alpha chain variable region.

олигонуклеотид А1, специфичный/ гомологичный к последовательности вариабельного участка альфа цепи, содержащего сайт рестрикции...

Note added at 5 hrs (2018-06-03 14:45:59 GMT)

прошу прощения: содержащий сайт рестрикции - это относится к олигонкуклеотиду

Igor Andreev
Local time: 06:52
Specializes in field
Native speaker of: Native in RussianRussian
PRO pts in category: 1142
Login to enter a peer comment (or grade)

Login or register (free and only takes a few minutes) to participate in this question.

You will also have access to many other tools and opportunities designed for those who have language-related jobs (or are passionate about them). Participation is free and the site has a strict confidentiality policy.

KudoZ™ translation help

The KudoZ network provides a framework for translators and others to assist each other with translations or explanations of terms and short phrases.

See also:

Your current localization setting


Select a language

Term search
  • All of
  • Term search
  • Jobs
  • Forums
  • Multiple search