
Italian translation: diretto / inverso

Login or register (free and only takes a few minutes) to participate in this question.

You will also have access to many other tools and opportunities designed for those who have language-related jobs (or are passionate about them). Participation is free and the site has a strict confidentiality policy.

14:58 Feb 27, 2018
English to Italian translations [PRO]
Tech/Engineering - Engineering (general)
English term or phrase: forward.../reverse...
Come tradurreste "forward... reverse ..."?

"DNA was extracted using QIAGEN mini-stool kit, according to the manufacturer’s protocol (Qiagen N.V., Venlo, The Netherlands). Primers for Streptococcus suis were forward CCAAAGCTTCATGACTGAATTGC and reverse CGACCACCGACACCGATG. Primers for total bacteria were forward GCAGGCCTAACACATGCAAGTC and reverse CTGCTGCCTCCCGTAGGAGT. Primers for lactobacilli were forward GCAGCAGTAGGGAATCTTCCA and reverse GCATTTCACCGCTACACATG."

Grazie !
Local time: 07:30
Italian translation:diretto / inverso
Vedi tra gli altri .
Selected response from:

Daniel Frisano
Local time: 07:30
Grading comment
4 KudoZ points were awarded for this answer

Summary of answers provided
Chiara Santoriello
4diretto / inverso
Daniel Frisano



1 hr   confidence: Answerer confidence 4/5Answerer confidence 4/5
diretto / inverso

Vedi tra gli altri .

Daniel Frisano
Local time: 07:30
Specializes in field
Native speaker of: Native in ItalianItalian, Native in FriulianFriulian
PRO pts in category: 266
Login to enter a peer comment (or grade)

18 hrs   confidence: Answerer confidence 5/5

It should be left in English also in Italian. There are only a few hits for diretto e inverso in Italian.

Chiara Santoriello
Local time: 07:30
Works in field
Native speaker of: Native in ItalianItalian
PRO pts in category: 8
Login to enter a peer comment (or grade)

KudoZ™ translation help

The KudoZ network provides a framework for translators and others to assist each other with translations or explanations of terms and short phrases.

See also:

Your current localization setting


Select a language

Term search
  • All of
  • Term search
  • Jobs
  • Forums
  • Multiple search