1. KudoZ home
  2. English to Italian
  3. Engineering (general)

forward.../reverse...

Italian translation: diretto / inverso

Login or register (free and only takes a few minutes) to participate in this question.

You will also have access to many other tools and opportunities designed for those who have language-related jobs (or are passionate about them). Participation is free and the site has a strict confidentiality policy.

14:58 Feb 27, 2018
English to Italian translations [PRO]
Tech/Engineering - Engineering (general)
English term or phrase: forward.../reverse...
Come tradurreste "forward... reverse ..."?

"DNA was extracted using QIAGEN mini-stool kit, according to the manufacturer’s protocol (Qiagen N.V., Venlo, The Netherlands). Primers for Streptococcus suis were forward CCAAAGCTTCATGACTGAATTGC and reverse CGACCACCGACACCGATG. Primers for total bacteria were forward GCAGGCCTAACACATGCAAGTC and reverse CTGCTGCCTCCCGTAGGAGT. Primers for lactobacilli were forward GCAGCAGTAGGGAATCTTCCA and reverse GCATTTCACCGCTACACATG."




Grazie !
MJV
Italy
Local time: 07:30
Italian translation:diretto / inverso
Explanation:
Vedi tra gli altri http://apollo11.isto.unibo.it/lab/3_primers.htm .
Selected response from:

Daniel Frisano
Monaco
Local time: 07:30
Grading comment
4 KudoZ points were awarded for this answer



Summary of answers provided
5forward/reverse
Chiara Santoriello
4diretto / inverso
Daniel Frisano


  

Answers


1 hr   confidence: Answerer confidence 4/5Answerer confidence 4/5
diretto / inverso


Explanation:
Vedi tra gli altri http://apollo11.isto.unibo.it/lab/3_primers.htm .


Daniel Frisano
Monaco
Local time: 07:30
Specializes in field
Native speaker of: Native in ItalianItalian, Native in FriulianFriulian
PRO pts in category: 266
Login to enter a peer comment (or grade)

18 hrs   confidence: Answerer confidence 5/5
forward/reverse


Explanation:
It should be left in English also in Italian. There are only a few hits for diretto e inverso in Italian.

Chiara Santoriello
Italy
Local time: 07:30
Works in field
Native speaker of: Native in ItalianItalian
PRO pts in category: 8
Login to enter a peer comment (or grade)



Return to KudoZ list

KudoZ™ translation help

The KudoZ network provides a framework for translators and others to assist each other with translations or explanations of terms and short phrases.

See also:
ProZ.com term search
Search millions of term translations

Your current localization setting

English

Select a language

More languages...
Close search
Term search
  • All of ProZ.com
  • Term search
  • Jobs
  • Forums
  • Multiple search