KudoZ home » English to Polish » Biology (-tech,-chem,micro-)

forward/backward (DNA sequence)

Polish translation: czytane do przodu/w tyl; współbieżnie/przeciwbieżnie

Advertisement

Login or register (free and only takes a few minutes) to participate in this question.

You will also have access to many other tools and opportunities designed for those who have language-related jobs
(or are passionate about them). Participation is free and the site has a strict confidentiality policy.
GLOSSARY ENTRY (DERIVED FROM QUESTION BELOW)
English term or phrase:forward/backward (DNA sequence)
Polish translation:czytane do przodu/w tyl; współbieżnie/przeciwbieżnie
Entered by: vladex
Options:
- Contribute to this entry
- Include in personal glossary

07:37 Mar 31, 2003
English to Polish translations [PRO]
Science - Biology (-tech,-chem,micro-) / biologia molekularna
English term or phrase: forward/backward (DNA sequence)
dwie sekwencje nukleotydów, np.: forward 5'ATGAGCTTCCTAGAGCAAGGAG3' , backward 5'CAGGTCTCAATCTTATGTTCTTC3';

"czytane do przodu/wstecz" ?
vladex
Local time: 23:52
czytane do przodu/w tyl
Explanation:
wstecz?
Selected response from:

Miroslawa Jodlowiec
United Kingdom
Local time: 22:52
Grading comment
tym razem niepełny zestaw punktów, bo zdecydowałem się na "współbieżnie/przeciwbieżnie"
3 KudoZ points were awarded for this answer

Advertisement


Summary of answers provided
3czytane do przodu/w tyl
Miroslawa Jodlowiec


  

Answers


12 days   confidence: Answerer confidence 3/5Answerer confidence 3/5
czytane do przodu/w tyl


Explanation:
wstecz?

Miroslawa Jodlowiec
United Kingdom
Local time: 22:52
Native speaker of: Native in PolishPolish
PRO pts in category: 7
Grading comment
tym razem niepełny zestaw punktów, bo zdecydowałem się na "współbieżnie/przeciwbieżnie"
Login to enter a peer comment (or grade)




Return to KudoZ list


KudoZ™ translation help
The KudoZ network provides a framework for translators and others to assist each other with translations or explanations of terms and short phrases.



See also:



Term search
  • All of ProZ.com
  • Term search
  • Jobs
  • Forums
  • Multiple search